Mathematics: How do I translate the following into an inequality?

How do I translate the following into an inequality?, №11723863, 21.11.2022 14:02

Mathematics

Perform the following: 1. translate the words into a mathematical expression: n more than 8. 2. translate the words into a mathematical expression: the product of 4 and a number g. 3. translate the words into a mathematical expression: the difference of 5 and twice x. 4. translate the words into a mathematical expression: the quotient of 6 and x. 5. translate the words into a mathematical expression: the sum of 3 times m and 9. 6. translate the words into a mathematical expression: 7 plus the quantity of 8 minus 6. 7. evaluate 8 - n if n = 3. 8.

Step-by-step answer

P Answered by Specialist

28

1. 8+n

2. 4g

3. 2x-5

4. 6/x

5. 3m +9

6. 7+(8-6)

7. If n = 3, 8 - n = 8 - 3
The answer is 5.

8. 18 / 9 = 2
The answer is 2.

9. If x = 4, ten 3x + 1 = 3(4) + 1 = 13
The answer is 13.

Thank you for posting your question. I hope you found you were after. Please feel free to ask me another.

Mathematics

Perform the following: 1. translate the words into a mathematical expression: n more than 8. 2. translate the words into a mathematical expression: the product of 4 and a number g. 3. translate the words into a mathematical expression: the difference of 5 and twice x. 4. translate the words into a mathematical expression: the quotient of 6 and x. 5. translate the words into a mathematical expression: the sum of 3 times m and 9. 6. translate the words into a mathematical expression: 7 plus the quantity of 8 minus 6. 7. evaluate 8 - n if n = 3. 8.

Step-by-step answer

P Answered by Master

28

1. 8+n

2. 4g

3. 2x-5

4. 6/x

5. 3m +9

6. 7+(8-6)

7. If n = 3, 8 - n = 8 - 3
The answer is 5.

8. 18 / 9 = 2
The answer is 2.

9. If x = 4, ten 3x + 1 = 3(4) + 1 = 13
The answer is 13.

Thank you for posting your question. I hope you found you were after. Please feel free to ask me another.

Spanish

Iwould appreciate it if someone could check my answers immediately ! i don t need answers, i just need someone to see if mine are correct. 1. translate the following into spanish: where is the door? a-dónde es la puerta? b-dónde están la puerta? c-dónde está la puerta? ** d-dónde estará la puert? 2. translate the following into spanish: the chair is next to the desk a-la silla está debajo del escritorio. b-la silla está al lado del escritorio.** c-la silla está detrás del escritorio. d-la silla está encima del escritorio. 3. translate the following

Step-by-step answer

P Answered by Specialist

2

In this problem, the answers are as follows and the explanation of each question has been attached in the file below:

1. Correct C- ¿Dónde está la puerta? 2. Correct B-La silla está al lado del escritorio 3. Correct D-El ratón está detrás del teclado.
4. Correct C-The flag is on the computer screen.
5. Correct A-El estudiante está delante de la ventana 6. Correct B-My pencil sharpener is in my backpack
7. Correct D- Los relojes están encima de la mesa
8. Correct D-de las
9. Correct D-de las
10. Correct Los
11. Correct Está
12. Correct Estamos
13. Correct are very literate
14. Correct are working to increase the student/computer ratio
15. Correct play at least one sport
16. Correct children are required to go to school until they are about 18
17. Correct They have both won Nobel Prizes
18. Correct Simón Bolívar
19. Correct He wrote a musical piece at age 5
20. Correct He had political differences with the Castro regime.

Spanish

Someone me and fast if possible? 1) translate the following into spanish: where is the door? a-dónde es la puerta? b-dónde están la puerta? c-dónde está la puerta? d-dónde estará la puert? 2) translate the following into spanish: the chair is next to the desk a-la silla está debajo del escritorio. b-la silla está al lado del escritorio. c-la silla está detrás del escritorio. d-la silla está encima del escritorio. 3) translate the following into spanish: the mouse is behind the keyboard. a-el ratón está delante del teclado. b-el ratón está encima

Step-by-step answer

P Answered by PhD

19

1 =C-Dónde está la puerta?
2=B-La silla está al lado del escritorio.
3=D- El ratón está detrás del teclado.*** correcto!
4=The flag is on the screen(C-The flag is on the computer screen. correcto!)
5=A-El estudiante está delante de la ventana correcto!
6=My pencil sharpener is in my backpack(B-My pencil sharpener is in my backpack correcto!)
7=D- Los relojes están encima de la mesa.
8= is either A or D
Hope this helps. c:

History

Translate the bible into german translated the new testament into greek translated the bible into english translated wycliffe’s works in czech pairs jan hus, desiderius erasmus, john wycliffe, martin luther

Step-by-step answer

P Answered by Master

11

IT'S THE CORRECT ANSWER!!!

Explanation:

i got it correct sooo, it's edmentum

History

Translate the bible into german translated the new testament into greek translated the bible into english translated wycliffe’s works in czech pairs jan hus, desiderius erasmus, john wycliffe, martin luther

Step-by-step answer

P Answered by Specialist

11

IT'S THE CORRECT ANSWER!!!

Explanation:

i got it correct sooo, it's edmentum

Biology

Please Help! The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right. AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set? 2. Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids. 3. Draw Conclusions Which of the three sets of amino

Step-by-step answer

P Answered by PhD

9

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

Spanish

Someone me and fast if possible? 1) translate the following into spanish: where is the door? a-dónde es la puerta? b-dónde están la puerta? c-dónde está la puerta? d-dónde estará la puert? 2) translate the following into spanish: the chair is next to the desk a-la silla está debajo del escritorio. b-la silla está al lado del escritorio. c-la silla está detrás del escritorio. d-la silla está encima del escritorio. 3) translate the following into spanish: the mouse is behind the keyboard. a-el ratón está delante del teclado. b-el ratón está encima

Step-by-step answer

P Answered by PhD

19

1 =C-Dónde está la puerta?
2=B-La silla está al lado del escritorio.
3=D- El ratón está detrás del teclado.*** correcto!
4=The flag is on the screen(C-The flag is on the computer screen. correcto!)
5=A-El estudiante está delante de la ventana correcto!
6=My pencil sharpener is in my backpack(B-My pencil sharpener is in my backpack correcto!)
7=D- Los relojes están encima de la mesa.
8= is either A or D
Hope this helps. c:

Spanish

1. What are possessive adjectives? 2. Possessive adjectives should agree with the noun they describe in what two things? 3. What are the forms of the possessive adjectives that mean our ? 4. What can su/sus mean? (hint: multiple meanings) 5. Would you say the following in Spanish, María s libro ? Why or why not? 6. Translate the following into Spanish: my pens 7. Translate the following into Spanish: our school 8. Translate the following into Spanish: his brother 9. Translate the following into Spanish: Ana s friend 10. Translate the following

Step-by-step answer

P Answered by Specialist

1

1. Adjectives that show that an object or person belongs to someone.

2. gender and number (plural or singular)

3. nuestro, nuestra, nuestros, nuestras

4. his, her, their, your

5. No. You would say "el libro de Maria" because you do not make a noun possessive by adding 's in Spanish.

6. Mis stylos

7. Nuestro escuela

8. Su hermano

9. El amigo (o la amiga) de Ana

10. La madre de Pablo

Explanation:

Hope this helps!

Spanish

Iwould appreciate it if someone could check my answers immediately ! i don t need answers, i just need someone to see if mine are correct. 1. translate the following into spanish: where is the door? a-dónde es la puerta? b-dónde están la puerta? c-dónde está la puerta? ** d-dónde estará la puert? 2. translate the following into spanish: the chair is next to the desk a-la silla está debajo del escritorio. b-la silla está al lado del escritorio.** c-la silla está detrás del escritorio. d-la silla está encima del escritorio. 3. translate the following

Step-by-step answer

P Answered by Master

2

In this problem, the answers are as follows and the explanation of each question has been attached in the file below:

1. Correct C- ¿Dónde está la puerta? 2. Correct B-La silla está al lado del escritorio 3. Correct D-El ratón está detrás del teclado.
4. Correct C-The flag is on the computer screen.
5. Correct A-El estudiante está delante de la ventana 6. Correct B-My pencil sharpener is in my backpack
7. Correct D- Los relojes están encima de la mesa
8. Correct D-de las
9. Correct D-de las
10. Correct Los
11. Correct Está
12. Correct Estamos
13. Correct are very literate
14. Correct are working to increase the student/computer ratio
15. Correct play at least one sport
16. Correct children are required to go to school until they are about 18
17. Correct They have both won Nobel Prizes
18. Correct Simón Bolívar
19. Correct He wrote a musical piece at age 5
20. Correct He had political differences with the Castro regime.

How do I translate the following into an inequality?

Faq

Try asking the Studen AI a question.